Isolation:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep ™ Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. .. Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V).
Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
Selection:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep ™ Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. .. Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V).
Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
other:
Article Title: Composition and structure of synaptic ectosomes exporting antigen receptor linked to functional CD40 ligand from helper T cells
Article Snippet: Briefly, CD4+ T cells were isolated by negative selection (RosetteSep Human CD4+ T cell Enrichment Kit, Stemcell technologies) following the manufacturer’s procedure.
Knockdown:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
Transfection:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
Plasmid Preparation:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
Expressing:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
shRNA:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
Control:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
Transduction:Article Title: TRAILshort protects against CD4 T cell death during acute HIV infection.
Article Snippet: TRAILshort Knockout by CRISPR-Cas9 Genome editing of TRAILshort (TNFSF10 gene, {"type":"entrez-nucleotide","attrs":{"text":"NM_003810","term_id":"1519311897"}} NM_003810 ) knockout mutation of Jurkat cell lines (ATCC # TIB-152) was contracted through Synthego (Synthego, Redwood City, CA). .. Primary uninfected CD4 T cells were isolated by negative selection using RosetteSep TM Human CD4 T cell Enrichment Kit (StemCell Technologies, Seattle, WA) according to the manufacturer’s protocol. . Ethics Statement All human samples (PBMCs) were obtained according to institutional review board (IRB)-approved protocols in compliance with institutional and federal regulations. . TRAILshort Knockdown Jurkat T cells were transfected with the pcDNA 6.2-GW/EmGFP-miR plasmid carrying the Blasticidin resistance gene (Invitrogen, Carlsbad, CA) expressing shRNA targeting exon 1 of TRAIL (GATCACGATCAGCACGCAGGTCGTTTTGGCCACTGACTGACGACCTGCGCTGATCGTGAT), or control (GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCAC GCAGTACATTT), supplied by Invitrogen or transduced with lentivirus (Mission pLK0.1-puro, Sigma, St. Louis, MO) carrying puromycin resistance and containing an siRNA that is specific for TRAILshort by targeting the exon 2/5 splice junction of TRAIL (GAAAGACTCCAAGAATGAA) or a non-targeting control (Sigma Mission pLK0.1-puro Non-Target shRNA Control, SHC016V). ..
|